HIV Sequence Locator API

A dead-simple web API for LANL's HIV sequence locator providing results in JSON. Positioning, region, and protein information is all available. Most of the data presented in the human-readable HTML page is extracted via this API. Get in touch if you need something that's missing!

Endpoint

POST .../within/hiv

Requires one or more values for the POST parameter sequence. Both protein and nucleotide sequences are accepted, although the data returned varies by type due to what LANL returns. See the curl example which queries a protein sequence and the same sequence as nucleotides.

On success (HTTP 200) the response body is a JSON array of objects, one per sequence. Both HTTP 4xx and 5xx status codes are used on failure with plain text bodies containing an error message.

HTTP Status Reason
405 Method Not Allowed The request did not use the HTTP POST method
422 Unprocessable Entity No sequence parameter was provided
503 Service Unavailable An unexpected condition occurred while parsing results from LANL
500 Internal Server Error An unexpected error occurred while processing your request

The API tries not to return incorrect data from misparses of LANL's output. If it detects an anomoly in any of its parsing stages, it will abort the request and return an HTTP 503 Service Unavailable. If this happens to your request, or if you are receiving results you don't expect, please let us know!


Created by Thomas Sibley of the Mullins Lab at the University of Washington, Department of Microbiology.

Questions? Drop us a line.

Source code

Examples

curl

curl -X POST http://indra.mullins.microbiol.washington.edu/locate-sequence/within/hiv \
     --data sequence=SLYNTVAVLYYVHQR \
     --data sequence=TCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGG
[
   {
      "query" : "sequence_1",
      "query_sequence" : "SLYNTVAVLYYVHQR",
      "base_type" : "amino acid",
      "reverse_complement" : "0",
      "alignment" : "\n Query SLYNTVAVLY YVHQR  15\n       :::::::.::  ::::    \n  HXB2 SLYNTVATLY CVHQR\n\n  ",
      "hxb2_sequence" : "SLYNTVATLYCVHQR",
      "similarity_to_hxb2" : "86.7",
      "start" : "77"
      "end" : "91",
      "genome_start" : "1018",
      "genome_end" : "1062",
      "polyprotein" : "Gag",
      "region_names" : [
         "Gag",
         "p17"
      ],
      "regions" : [
         {
            "cds" : "Gag",
            "aa_from_cds_start" : [
               "229",
               "273"
            ],
            "aa_from_polyprotein_start" : null,
            "aa_from_protein_start" : [
               "77",
               "91"
            ],
            "aa_from_query_start" : [
               "1",
               "15"
            ],
            "na_from_hxb2_start" : [
               "1018",
               "1062"
            ]
         },
         {
            "cds" : "p17",
            "aa_from_cds_start" : [
               "229",
               "273"
            ],
            "aa_from_polyprotein_start" : null,
            "aa_from_protein_start" : [
               "77",
               "91"
            ],
            "aa_from_query_start" : [
               "1",
               "15"
            ],
            "na_from_hxb2_start" : [
               "1018",
               "1062"
            ]
         }
      ],
   },
   {
      "query" : "sequence_2",
      "query_sequence" : "TCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGG",
      "base_type" : "nucleotide",
      "reverse_complement" : "0",
      "alignment" : "\n Query TCATTATATA ATACAGTAGC AACCCTCTAT TGTGTGCATC AAAGG  45\n       :::::::::: :::::::::: :::::::::: :::::::::: ::::: \n  HXB2 TCATTATATA ATACAGTAGC AACCCTCTAT TGTGTGCATC AAAGG  1062\n\n  ",
      "hxb2_sequence" : "TCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGG",
      "similarity_to_hxb2" : "100.0",
      "start" : "229"
      "end" : "273",
      "genome_start" : "1018",
      "genome_end" : "1062",
      "polyprotein" : "Gag",
      "region_names" : [
         "Gag",
         "p17"
      ],
      "regions" : [
         {
            "cds" : "Gag",
            "aa_from_protein_start" : [
               "77",
               "91"
            ],
            "na_from_cds_start" : [
               "229",
               "273"
            ],
            "na_from_hxb2_start" : [
               "1018",
               "1062"
            ],
            "na_from_query_start" : [
               "1",
               "45"
            ],
            "protein_translation" : "SLYNTVATLYCVHQR"
         },
         {
            "cds" : "p17",
            "aa_from_protein_start" : [
               "77",
               "91"
            ],
            "na_from_cds_start" : [
               "229",
               "273"
            ],
            "na_from_hxb2_start" : [
               "1018",
               "1062"
            ],
            "na_from_query_start" : [
               "1",
               "45"
            ],
            "protein_translation" : "SLYNTVATLYCVHQR"
         }
      ],
   }
]

Perl

Directly using Bio::WebService::LANL::SequenceLocator

#!/usr/bin/env perl
#
# First install the library:
#   cpan -i Bio::WebService::LANL::SequenceLocator
# 
use strict;
use warnings;
use Bio::WebService::LANL::SequenceLocator;

my $locator = Bio::WebService::LANL::SequenceLocator->new(
    agent_string => 'Your Organization - you@example.com',
);

my @sequences = $locator->find([
    "agcaatcagatggtcagccaaaattgccctatagtgcagaacatcc"
   ."aggggcaagtggtacatcaggccatatcacctagaactttaaatgca",
]);

Through our web API

#!/usr/bin/env perl
use strict;
use warnings;

use JSON qw< decode_json >;
use LWP::UserAgent;

my $agent    = LWP::UserAgent->new( agent => 'you@example.com' );
my $response = $agent->post(
    "http://indra.mullins.microbiol.washington.edu/locate-sequence/within/hiv" => [
        sequence => "TCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGG",
    ],
);
unless ($response->is_success) {
    die "Request failed: ", $response->status_line, "\n",
        $response->decoded_content;
}
my $results = decode_json( $response->decoded_content );

# $results is now an array ref, like the JSON above
print $results->[0]{polyprotein}, "\n";

Python

#!/usr/bin/env python2
from urllib2 import Request, urlopen, URLError
from urllib  import urlencode
import json

request = Request('http://indra.microbiol.washington.edu/locate-sequence/within/hiv')
data = urlencode({
    'sequence': [
        'SLYNTVAVLYYVHQR',
        'TCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGG'
    ]
}, True);

try:
    response = urlopen(request, data)
    text     = response.read()
    results  = json.loads(text)
except URLError, e:
    print 'Request failed: ', e
except ValueError, e:
    print 'Decoding JSON failed: ', e
finally:
    if results == None:
        exit(1)

print results